Combined morphological and molecular approaches to the clinical diagnosis of Necator americanus infection: a case report

Abstract

Background

Hookworm infection remains of considerable importance to public health. However, because critical cases caused by hookworm infection are rarely observed in China, accurate and prompt diagnoses are difficult to achieve in clinical practice. In this study, we describe how we combined morphological and molecular approaches to achieve the clinical diagnosis of hookworm infection.

Case presentation

A 75-year-old Chinese woman who presented with dizziness, poor appetite, poor sleep, and weakness in her limbs was diagnosed with chronic atrophic gastritis and was positive for Helicobacter pylori, iron deficiency anemia with a hemoglobin concentration of 35 g/L, and left atrial enlargement. However, after symptomatic treatment, the patient did not improve. Upper gastrointestinal endoscopy revealed the presence of live nematodes in the descending portion of the patient’s duodenum. Fecal examination via saturated brine flotation revealed hookworm eggs. Further verification via semi-nested reverse transcription-polymerase chain reaction assay confirmed provided confirmation that the hookworm species was Necator americanus. Albendazole was used for antihelminthic treatment. Through follow-up visits, we found that the antihelminthic treatment was successful and that her anemia was cured.

Conclusion

In this study, a combination of morphological and molecular approaches were used to make a definite diagnosis of severe iron deficiency anemia caused by Necator americanus infection in a patient. The results presented here provide suitable guidance for the clinical diagnosis of hookworm infection and a powerful tool for the identification of hookworms.

Introduction

Hookworm is one of the most prevalent soil-transmitted helminths (STH), and hookworm infections result in an estimated 2.1 million disability-adjusted life years (DALYs) lost, accounting for more than US $100 billion in global economic losses [1,2,3,4]. Hookworm infection in humans is usually caused by the species Ancylostoma duodenale and Necator americanus [5, 6]. These two species differ in terms of geographical distribution [2, 7], egg production, density-dependent fecundity effects, and their contribution to morbidity [8]. However, although performing accurate species identification of hookworms for clinical etiological diagnoses is still difficult, the application of molecular biotechnology has been shown to be useful.

Humans frequently become infected with hookworms through skin penetration following contact with soil or vegetation contaminated with third-stage larvae (L3) [9, 10]. Hookworms parasitize the small bowels of humans and release anticoagulative substances and enzymes to facilitate blood sucking; therefore, gastrointestinal symptoms and iron deficiency anemia (IDA) are the principal clinical symptoms of hookworm infection [11]. When many hookworms infest the intestines, patients generally present with severe IDA due to chronic massive blood loss [12]. The mean hemoglobin concentration can be reduced to 98 g/L over 3 months [1], even declining to 53 g/L in neonates [12,13,14].

In this study, we report a case involving a patient with severe IDA caused by Necator americanus infection who presented with a very low hemoglobin concentration of 35 g/L and was initially diagnosed with chronic atrophic gastritis and myelodysplastic syndrome (MDS).

Case presentation

The patient was a 75-year-old Chinese woman who was a farmer from Yongzhou City, Hunan Province, China. A total of 2 months prior, the patient presented with symptoms of dizziness, poor appetite, poor sleep, and weakness in the limbs without any obvious cause. The patient gradually worsened and was diagnosed with chronic atrophic gastritis with Helicobacter pylori (Hp) positivity, hypoproteinemia, and IDA. Moreover, left atrial enlargement and left ventricular diastolic dysfunction were diagnosed via echocardiography.

The results of routine blood tests were as follows: a red blood cell (RBC) count of 1.84 × 10¹²/L, hematocrit level of 13%, platelet count of 500 × 10⁹/L, hemoglobin level of 35 g/L (critical value), mean corpuscular volume of 70.7 fL, total protein level of 44.6 g/L, eosinophil ratio of 5.3%, erythrocyte sedimentation rate of 25 mm/h, immunoglobulin (Ig)E level of 1282.2 IU/ml, serum Fe level of 3.85 μmol/L, and positive fecal occult blood test result. Her bone marrow cytomorphologic examination revealed active proliferation of the granulocyte, megakaryocyte, and myeloid cell series. A flow cytometry examination did not indicate the abnormal immunophenotypes indicative of acute leukemia, MDS, lymphoma, or myeloid tumors. Gastrointestinal endoscopy showed live nematodes in the descending portion of the patient’s duodenum. The patient was treated with leukocyte-reduced red blood cells to correct severe anemia and the antihelminthic albendazole. After treatment, her hemoglobin level was confirmed to be 77 g/L. During follow-up visits, the patient successfully underwent antihelminthic treatment, and her anemia was cured.

Imaging and morphological examination

To rule out gastrointestinal disease, the patient underwent gastrointestinal endoscopy. Live nematodes were discovered feeding on the mucosa of the descending portion of the patient’s duodenum (Fig. 1). Hookworm eggs were found in the stool via saturated brine flotation (Fig. 2). Therefore, the patient ultimately was diagnosed with severe IDA caused by hookworm infection.

Fig. 1

Gastrointestinal endoscope showing cylindrical worms feeding on the small intestine mucosa in the duodenum

Fig. 2

Stool examination by saturated brine flotation showing hookworm eggs

Molecular identification of the hookworm species

Semi-nested reverse transcription-polymerase chain reaction (RT-PCR) was performed to identify the species of hookworm. Total DNA was extracted from fecal samples via the Mol Pure^® Stool DNA Kit (18820ES50) by Yi Sheng Biotechnology (Shanghai, China). The primers (forward primer NC1: ACGTCTGGTTCAGGGTTCTT; reverse primer NC2: TTAGTTTCTTTTCCTCCGCT) were designed to amplify the second internal transcribed spacer (ITS2) and 28S RNA region of the ribosomal DNA of the hookworm. The amplification condition for the first round of the semi-nested RT-PCR included denaturation at 95 ℃ for 3 minutes; followed by 35 cycles: denaturation at 95 ℃ for 10 seconds, annealing at 55 ℃ for 20 seconds, and extension at 72 ℃ for 30 seconds; and a final extension at 72 ℃ for 5 minutes. The amplified PCR product was used for the second step of the semi-nested PCR. The primer NC2 was used as the common reverse primer, whereas the first forward primer AD1: CGACTTTAGAACGTTTCGGC was used for A. duodenale, and the second forward primer NA: ATGTGCACGTTATTCACT was used for N. americanus. The amplification conditions included denaturation at 95 ℃ for 3 minutes; followed by 35 cycles: denaturation at 95 ℃ for 10 seconds, annealing of AD1 at 60 ℃ for 20 seconds, annealing of NA at 55 ℃ for 20 seconds, and extension at 72 ℃ for 30 seconds; and a final extension at 72 ℃ for 5 minutes. The PCR products were electrophoresed in a 1% agarose gel and visualized under ultraviolet (UV) light.

The first round of the semi-nested PCR was performed in a 10-μL reaction volume containing 5 μL of Premix Taq, 0.6 μL of extracted DNA, 0.2 μL of each primer (10 pmol), and 4 μL of water. For the second round, the PCR mixture contained 15 μL of Premix Taq, 1.8 μL of extracted DNA, 0.6 μL of each primer (10 pmol), and 12 μL of water for a final volume of 30 μL.

The product of the semi-nested RT-PCR was submitted to Bioengineering (Shanghai, China) for DNA sequencing, and the results were compared via BLAST algorithms and databases from the National Center for Biotechnology Information database (Fig. 3). The DNA sequencing results were as follows: TTGTTTACT AACGTATGATAGCGGTGCATACTGTATGACATGAACATATCGTTGTTCACTGTTTAATCGCTCTCGCGACTTATGAGCGTGGTTGAACGGAGACAATGTGAAGGACAACGATGTTCGCCATGTGGATGTGTCATTTGCAATGCAACCTGAGCTCAGGCGTGATTACCCGCTGAACTTAAGCATATCATTTAGCGGAGGAAAAGAAACTAAATG. Finally, we confirmed that the hookworm species was N. americanus.

Fig. 3

DNA sequence alignment with GenBank showing the hookworm species as N. americanus

Discussion

Hookworm infection is one of the neglected tropical diseases (NTDs) that are still widespread and impose a substantial burden in low-income and middle-income countries, despite the implementation of mass drug administration (MDA) programs [15,16,17,18]. Owing to social and economic development, the popularization of sanitary toilets, an improved supply of clean water, and the implementation of control measures, the prevalence of hookworm infection in China has decreased drastically [19]. According to the national parasite surveys in 1988–1992, 2001–2004 [20], and 2014–2016 [21], the rate of hookworm infection decreased from 17.2% to 2.6%. In 2020, the rate of hookworm infection was 0.51% [22]. Hunan Province has also made significant progress in controlling hookworms, and the rate of hookworm infection decreased from 22.86% in 1994 to 0.43% in 2020 [22]. Although the rate of hookworm infection remains low, the risk remains. Hookworm disease is easily misdiagnosed because the clinical symptoms such as gastrointestinal symptoms and anemia are atypical [23]. The long-term effects of anemia may produce ventricular dilation and edema, ultimately triggering heart failure [24]. Thus, identification and subsequent correction of these conditions are very important in this patient group [25]. Although the patient had no obvious gastrointestinal bleeding, her hemoglobin concentration was exceptionally low at just 35 g/L, which is much lower than that typically observed in patients with hookworm infection. The underlying reasons might be related to the patient’s living environment or dietary and lifestyle habits. In addition, the patient did not receive anthelmintic treatment in a timely manner.

Species identification of hookworms is essential for treatment and control in national surveillance. In poor tropical and subtropical areas, many patients have extensive hookworm infestations, but very few of them show symptoms of overt bleeding from the gastrointestinal tract, leading to the infections being ignored [26]. In addition, it is not easy to identify the species of hookworm accurately through routine stool testing alone [13]. In this case, semi-nested RT-PCR was used to amplify the internal transcribed spacer of the hookworm, and the sequencing results confirmed that the hookworm species was Necator americanus. The patient’s hemoglobin level was confirmed to be 77 g/L and the patient’s symptoms of dizziness, poor appetite, poor sleep, and weakness in the limbs disappeared after treatment with albendazole and leukocyte-reduced red blood cells. During follow-up visits, we found that the antihelminthic treatment was successful and that the patient’s anemia was cured.

Obscure upper gastrointestinal bleeding (UGIB) is defined as bleeding in the upper gastrointestinal tract without an identifiable source [27]. Patients with obscure upper gastrointestinal bleeding are often diagnosed with IDA, and their symptoms do not significantly improve when anti-anemia treatment is administered. Hence, the timely detection of the cause of IDA in patients is extremely important for treatment and prognosis. Capsule endoscopy (CE) [28], esophagogastroduodenoscopy, and double-balloon endoscopy (DBE) [29] are common methods of examining the upper gastrointestinal tract. Because most hookworm-infected individuals present with chronic occult bleeding, hookworm infection should be considered in the differential diagnosis of patients with IDA in low-income and middle-income countries. Further progress and developments in virtual endoscopy, such as the incorporation of computed tomography (CT) and magnetic resonance imaging, are expected in the future [30], which will provide new treatment methods for UGIB.

Conclusion

In this study, combined morphological and molecular approaches were used to make a definite diagnosis of severe iron deficiency anemia caused by Necator americanus infection in a patient. The results presented here provide suitable guidance for the clinical diagnosis of hookworm infection and a powerful tool for the identification of hookworms. Special attention should be given in high-endemic areas, especially among older people.